Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AutoMoveImage

-

Move images automatically


CommandArgument DatatypeDefaultMinMax
Format:AutoMoveImage Image selection, SELECTION ---
   X = new top left X-coordinate of shown area in pixels ,FLOAT0.0--
  Y = new top left Y-coordinate of shown area in pixels,FLOAT 0.0 --
  Width = new width of shown area in pixels,FLOAT original width --
   Height = new weight of shown area in pixels,FLOAToriginal height --
   Alpha = new alpha blending factor in percent,FLOAT100.00.0100.0
  Steps = number of steps till new coordinates are reached, INT120--
  Cycle = Cycle between original and new coordinates Off | MoveBack | JumpBack, STRINGOff - -
   Zoom3D = Make 3D zooms with correct perspective (instead of linear interpolation) yes | no STRINGno--
Python:AutoMoveImage(selection1,x=None,y=None,width=None,height=None,alpha=None,steps=None,cycle=None,zoom3d=None)
Menu:Effects > Image > Move automatically
Related:LoadBMP, LoadPNG , ShowImage, AnimateImage , SwapImage, HideImage , DelImage, MakeImageObj
Required:


The AutoMoveImage command starts an automatic zoom from the currently shown area of the selected image to the newly specified area in the given number of steps .

If the Cycle parameter is set to 'Yes', the automatic movement will cycle back and forth, otherwise it will stop as soon as the new area is reached.

Image coordinates originate from the top left image corner (0/0), with the X-axis pointing right and the Y-axis pointing downwards.

Example 1:
AutoMoveImage 1,X=150,Y=100,Width=400,Height=300,Alpha=50,Steps=200

Zoom from the current view of image 1 to a rectangular 400x300 area at coordinates 150/100 in 200 steps. The image becomes half transparent (alpha=50).


Example 2:
AutoMoveImage 1,X=150,Y=100,Width=400,Height=300,Alpha=0,Steps=300,Zoom3D=Yes

Move from the current view of image 1 to a rectangular 400x300 area at coordinates 150/100 in 300 steps. During the movement, the image disappears (alpha=0).