Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Analyzing the soup

Insert or I Show/hide the head up display (HUD)
Ctrl+Insert or Ctrl+I Change the data displayed in the right HUD (YASARA Dynamics and above)
LeftClick on atom Mark atom, display its properties in the HUD
LeftClick on sequence selector Mark atom in clicked residue
PageDown or MouseWheelDown Mark next atom, see MouseWheel command.
PageUp or MouseWheelUp Mark previous atom, see MouseWheel command.
Ctrl+LeftClick on atoms Display distance / angle / dihedral in the left HUD (one atom must be marked)
Ctrl+LeftClick on sequence selector Zoom in on the clicked residue
RightClick on marked atom Show atom context menu
RightClick on sequence selector Show residue context menu
Home Show details about the previous charge or bond in the simulation HUD (YASARA Dynamics and above)
End Show details about the next charge or bond in the simulation HUD (YASARA Dynamics and above)
Pointer on sequence selector + lettersFind the amino acid sequence typed in one letter code while the mouse pointer is placed on top of the sequence selector