Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AtomTexture

-

Set texture style of atoms


CommandArgument DatatypeDefaultMinMax
Format:AtomTexture Type = Texture type INT-18
Python: AtomTexture(Type)
Menu:View > Atom appearance > Texture
Related:AtomSymbol, AtomSize , AtomPlasma, Color
Required:


The AtomTexture command applies the selected texture to the atoms shown as balls or sticks. Only the first two textures are available in YASARA View.

Example 1:
AtomTexture 1

Display plain atoms with a spot light reflection.


Example 2:
AtomTexture 2

Display plain atoms without any reflection.


Example 3:
AtomTexture 3

Display atoms with a sky cloud reflection.


Example 4:
AtomTexture 4

Display bumpy atoms.


Example 5:
AtomTexture 5

Display atoms with an agate texture.


Example 6:
AtomTexture 6

Display crackled atoms.


Example 7:
AtomTexture 7

Display atoms with a granite texture.


Example 8:
AtomTexture 8

Display atoms in comic style.



Example macro 1:

# EXAMPLE AtomTexture
# Requires YASARA Model
Clear
LoadPDB 1crn
Style Ball
Pos Z=15.5
Color Grey
AtomTexture 7

Figure: Result of the example macro 1 above.



Example macro 2:

# EXAMPLE AtomTexture Comic
# Requires YASARA Model
Clear
LoadYOb 1fe0
Style Ball
Pos Z=20
ColorRes all,blue,cyan
AtomTexture 8

Figure: Result of the example macro 2 above.