Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AtomSymbol

-

Switch element symbol inside atoms on/off


CommandArgument DatatypeDefaultMinMax
Format:AtomSymbolFlag = On | Off STRING---
Python:AtomSymbol(flag)
Menu:View > Atom appearance > Element symbol
Related: AtomTexture , AtomPlasma, AtomSize
Required:


The AtomSymbol command toggles the display of the chemical element symbol inside those atoms that are cut open by the viewplane.

Example 1:
AtomSymbol On

Show the chemical element symbol inside atoms that intersect with the viewplane.


Example 2:
AtomSymbol Off

Do not show the chemical element symbol.