Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AtomSize

-

Set size of atoms


CommandArgument DatatypeDefaultMinMax
Format:AtomSize Radius = average atom radiusINT- 5 100
Python: AtomSize(radius)
Menu:View > Atom appearance > Size
Related:AtomTexture, AtomSymbol , AtomPlasma, Projection
Required:


The AtomSize command changes the size of atoms on screen, i.e. the relation between an Angstrom in the soup and a pixel on screen.

If the atom size is reduced, atoms will be smaller when they touch the near clipping plane, hence changing the atom size is equivalent to shifting the near clipping plane in other programs.

The atom size saved with a scene is rounded to 50, 75 or 100, whichever number is closest.

Example 1:
AtomSize 5

When atoms get close and touch the near clipping plane, they are extremely small, 1 Angstrom corresponds to about a pixel on screen.


Example 2:
AtomSize 100

The opposite, when atoms get close and touch the near clipping plane, they are relatively large, 1 Angstrom corresponds to lots of pixels on screen.