Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AtomPlasma

-

Switch plasma inside atoms on/off


CommandArgumentDatatypeDefault Min Max
Format: AtomPlasma Flag = On | OffSTRING ---
Python: AtomPlasma(flag)
Menu:View > Atom appearance > Plasma
Related:AtomSymbol, AtomTexture , AtomSize
Required:


The AtomPlasma command toggles a graphical effect that may serve as an eye-catcher during a presentation given with YASARA: if atoms are cut open by the near clipping plane, a moving plasma will be shown inside.

Example:
AtomPlasma On

Show a wobbling plasma as soon as atoms intersect with the viewplane.