Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Atom

-

YASARA's representation of a true atom

Contrary to real atoms, YASARA's atoms can easily be distinguished: Every atom has a unique number and many attached properties, like chemical element, atom name, residue name, residue number, molecule name etc. Each YASARA atom maps directly to one line in a PDB file. Here is an example from 1c9b.pdb:


ATOM    105  CA  THR A 123      19.779  20.075  26.943  1.00 53.14           C

The line above describes atom 105 with name 'CA' and cartesian coordinates (19.8/20.1/27.0), belonging to residue 'Thr 123' in molecule (=chain) 'A', with an occupancy of 1.00 (fully present), a B-factor of 53.1 and finally - the chemical element is 'C'.

YASARA numbers all the atoms continuously, starting with 1. As a direct consequence, YASARA atom numbers will not always be the same as those given in the PDB file (because PDB files also number 'TER' entries, and YASARA can load many PDB files at the same time). In addition, atom numbers change frequently (for example when adding hydrogen atoms). When writing a macro, it is therefore suggested to select atoms using their name and the residue they belong to, but not using their number.

If you ever have to modify a PDB file, remember that all characters must be placed in the right column. See www.rcsb.org for a complete description of the PDB file format.

For chemical consistency, YASARA removes numbers from chemically equivalent hydrogens. More details about this mechanism can be found here.

Figure: One single carbon atom, created with the BuildAtom command.