Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Analyzing the ensemble

The fourth and final step is to calculate a total energy for each ensemble member, which is now not limited to restraint violations , but includes force field and solvation energies . The results are saved as 'result.log'. If you own the Twinset, they also include the three most important WHAT_CHECKs: RAMCHK, BBCCHK and QUACHK.

The ensemble members are then sorted with respect to this energy, so that the first structure in the ensemble is the best, then superposed on their secondary structure elements and saved together in one PDB file, by default 'ensemble.pdb'.

All the details can be found in the macro 'nmr_analyze'.