Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Additional selection types allow to filter for various properties

There are a number of selection types that you can only use as part of a selection, but not as a command extension.

° 

'Element' switches to a selection of chemical elements

You can select chemical elements by their one/two letter abbreviation, their full name or their number in the periodic table.

Examples:
ColorAtom Element H Carbon 8,Red
Color atoms that are hydrogens or carbons or oxygens red
DelAtom Element 1
Delete all hydrogen atoms
ColorRes Element S,Blue
Color all residues containing a sulfur atom blue
DelAtom Element C-O
Delete all carbon, nitrogen and oxygen atoms

° 

'SecStr' switches to a selection of secondary structure types

After switching to the 'SecStr' selection type, use the keywords 'Strand', 'Helix', 'Turn' or 'Coil'.

Examples:
ColorRes SecStr Helix,Red
Color all residues in a helix red
ColorRes SecStr Turn Coil,Gray
Color all residues in turn or coil gray
DelMol SecStr Strand
Delete all molecules that contain a strand

° 

'Segment' switches to a selection of macromolecular segments

The PDB format reserves four characters in columns 73-76 to specify a segment ID, e.g. to distinguish the light and heavy chains in antibodies. In old PDB files, the segment ID is often the same as the PDB ID.

Examples:
ColorMol Segment HEAV, Green
Color all molecules belonging to segment 'HEAV' green
ListRestAtom Segment "   A",Distance
List all NMR distance restraints involving atoms in segment A

° 

'AltLoc' switches to a selection of alternate conformations

Sometimes a bunch of atoms (mostly side-chains) can be seen at two or more distinct locations in the X-ray density map. These atoms are then present multiple times in the PDB file, but with different 'alternate location (AltLoc) indicators'. The 'AltLoc' selection type allows to choose one of these multiple conformations.

Examples:
DelAtom AltLoc B
Delete all atoms with an alternate location indicator 'B'
DelAtom AltLoc B-Z
Delete all atoms with AltLoc indicators B to Z

° 

'Protein', 'NucAcid' and 'HetGroup' immediately select proteins, nucleic acids and the rest

Contrary to the previous selection types, these three do not require an actual selection afterwards. That's why they leave the selection type unaltered, nevertheless they perform an implicit logical AND like all the others above.

Examples:
DelMol NucAcid
Delete all nucleic acid molecules
DelAtom CA CB Protein
Delete all atoms named CA or CB and belonging to a protein
DelRes HetGroup
Delete everything that is neither a protein nor a nucleic acid

° 

'Backbone', 'Sidechain' and 'Visible' immediately select backbone, side-chain and visible atoms

Everthing said for 'Protein', 'NucAcid' and 'HetGroup' also applies to these three. Note that the 'visible' selector looks at the atom visibilities set with Show and Hide , not at the object visibilities set with Switch .

Examples:
ColorAtom Sidechain,Blue
Color all side-chain atoms blue
ColorAtom Res Glu Asp Backbone,Red
Color the backbone of Glu or Asp residues red
DelRes Sidechain
Delete all residues with a side-chain (no glycines)
ShowSurfAtom O Res HOH visible,VdW
Show a Van der Waals surface for all visible water oxygens
DelAtom !visible
Delete all invisible atoms

° 

'PDB', 'PDBRev', 'YASARA', 'IUPAC' and 'XPLOR' change the atom naming scheme

Over the last decades, slightly different atom naming schemes have been introduced. For example YASARA and XPLOR name the terminal oxygens OT1 and OT2 to indicate their chemical equivalence, while the PDB prefers O and OXT, and IUPAC suggests O' and O''. If you are working in NMR spectroscopy, you are also used to the many problems associated with hydrogen nomenclature, which are described in more detail here.

The operators described here allow to change the current naming scheme when selecting atoms. The new scheme stays valid until the next change or the next explicit operator. In the latter case, it is changed back to YASARA's own default names.

Examples:
ColorAtom PDB 1HB,blue
Color the first of all equivalent beta-hydrogens blue
ColorAtom XPLOR HB2,yellow
Color all atoms whose XPLOR name is HB2 yellow
DelAtom IUPAC HG3 PDB 1HB
Delete atoms whose IUPAC name is HG3 plus those whose PDB name is 1HB
DelAtom PDB OXT
Delete all terminal oxygens
ListAtom PDB 1HG and XPLOR HG2
List the first of all gamma-methylene hydrogen pairs

° 

'LocalX|Y|Z<>X' and 'GlobalX|Y|Z<>X' select atoms by their position

Sometimes it is helpful to select atoms by their position, for example to slice a protein open and show only the back half. In YASARA, every atom has actually two positions, first the position in the local coordinate system of the object (which is specified in the PDB file), and second the position in the global coordinate system of the screen. Like those in the previous sections, the operators described here perform an implicit logical 'and'.

Examples:
HideAtom localX<0
Hide atoms with an X-position < 0 in the local coordinate system
ShowAtom localY>5 localZ<-10
Show atoms with a local Y-position > 5 and a local Z-position < -10
HideAtom globalY<0
Hide atoms with a Y-position < 0 in the global coordinate system
HideAtom globalX>0
Hide atoms in the right half of the screen

° 

'BFactor<>X', 'Occupancy<>X' and 'Property<>X' select atoms by B-factor, occupancy and property value

In addition to coloring by BFactor , Occupancy and Property value, you can also use them to select atoms.

Examples:
CountAtom BFactor>60
Count the number of very flexible atoms
DelAtom Occupancy<0.5
Delete all atoms with an occupancy smaller than 50%
HideAtom Property=0
Hide all atoms whose property value is zero

° 

'Charge<=>X' selects units by their charge

The Charge selection operator sums up the net charge of each unit (depending the current selection type) and selects those units that pass the comparison. If a force field has been initialized, the force field charge is used, otherwise YASARA resorts to the formal charge calculated from bond orders and standard atom valences.

Examples:
ListAtom Charge<0
List all atoms with a negative charge
ColorRes Charge!=0,red
Color all charged residues red
ListRes Asp Glu Charge=0
List all aspartates and glutamates that are neutral
ColorObj Charge>0,yellow
Color all objects with a positive net charge yellow