A red box appears: Error 93 - Center of YASARA window off screen

CAP - Catabolite gene Activating Protein (1BER)

DNA - GATTACAGATTACAGATTACA

Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI)

DNA - GATTACAGATTACAGATTACA

TBP - TATA box Binding Protein (1C9B)

GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)

GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)

GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)

GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)

TBP - TATA box Binding Protein (1C9B)

°	A red box appears: Error 93 - Center of YASARA window off screen

If you have been able to start YASARA in the past, then the reason for this error is most likely the one described in the error box. Restart YASARA, and if this does not help, delete the file yasara.ini to set the window size back to the default.

If this is the first time you try to run YASARA, then the reason for this error is almost certainly a bug or incomplete functionality in your OpenGL graphics driver. The following hardware configurations have been reported to occasionally cause this problem:

Linux with some ATI Radeon cards and a Tungsten Graphics/Mesa DRI OpenGL driver. Type
```
glxinfo
```
and check if the output contains the following lines:
```
OpenGL vendor string: Tungsten Graphics, Inc.
OpenGL renderer string: Mesa DRI Radeon 20020611 AGP 1x x86/MMX/SSE NO-TCL
OpenGL version string: 1.2 Mesa 4.0.4
```
If this is indeed the case, click here for instructions how to install the high-performance ATI Radeon graphics driver.

Windows with some exotic, not entirely OpenGL compliant integrated graphics chipsets like the SiS Mirage 2 (SiS760GX chipset, version 3.75). Please notify us if a newer driver version solves the problem.