Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

A red box appears: Error 53 or 353 - No vector registers available or wrong CPU architecture

There are two reasons for this error message:

  • When downloading YASARA, you selected a different CPU than the one in your computer. Go to www.yasara.org/update, input the serial number that is listed in our mail with the initial download link, and choose 'Many different, I want to install on multiple PCs' as your CPU.

  • When downloading YASARA, you did not select a specific CPU. In this case, the processor in your PC is either many many years too old for molecular modeling (Pentium MMX, Pentium II, AMD K6 etc.) or a rather exotic model that is incompatible with the current mainstream CPUs. You can unfortunately not run YASARA on this PC.