Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

A red box appears: Error 2 - Essential videomode not supported under Linux

One possible explanation is that YASARA tried to enter fullscreen mode using an extremely high resolution screen (or two screens combined with TwinView etc.). In this case just delete the file yasara/yasara.ini and restart.

If this does not help, open a terminal, type glxinfo and check the output for available visuals. It should look a bit like that:


   visual  x  bf lv rg d st colorbuffer ax dp st accumbuffer  ms  cav
 id dep cl sp sz l  ci b ro  r  g  b  a bf th cl  r  g  b  a ns b eat
----------------------------------------------------------------------
0x21 16 tc  0 16  0 r  y  .  5  6  5  0  0 16  0 16 16 16 16  0 0 None
0x22 16 dc  0 16  0 r  y  .  5  6  5  0  0 16  0 16 16 16 16  0 0 None
0x23 16 tc  0 16  0 r  .  .  5  6  5  0  0 16  0 16 16 16 16  0 0 None
0x24 16 tc  0 16  0 r  y  .  5  6  5  0  0  0  0 16 16 16 16  0 0 None
0x25 16 tc  0 16  0 r  .  .  5  6  5  0  0  0  0 16 16 16 16  0 0 None
0x26 16 dc  0 16  0 r  .  .  5  6  5  0  0 16  0 16 16 16 16  0 0 None
0x27 16 dc  0 16  0 r  y  .  5  6  5  0  0  0  0 16 16 16 16  0 0 None
0x28 16 dc  0 16  0 r  .  .  5  6  5  0  0  0  0 16 16 16 16  0 0 None

If you get nothing comparable, you need to install OpenGL drivers for your video card. Contact your system administrator if you do not have the root password, otherwise visit www.nvidia.com or www.ati.com for more details.