Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Antialias

-

Switch antialiasing on/off


CommandArgument DatatypeDefaultMinMax
Format:Antialias Flag = On | OffSTRING - --
Python:Antialias(flag)
Menu:Window > Antialiasing
Required:


YASARA's antialiasing is independent of the current OpenGL settings. It works with 256 sub-samples per pixel (2 to 4 are common) and has virtually no performance impact for molecules up to a few thousand atoms. When working with the ribosome (~100000 atoms), the screen update is however noticeably faster without antialiasing. Activating antialiasing in your OpenGL settings is not recommended, because the fonts will become blurred and harder to read. Also NVIDIA's drivers mess up the screen when you type in the console.

In console mode, the Antialias command affects only the PovRay output.

Example 1:
Antialias On

Activate antialiasing, smooth the balls.


Example 2:
Antialias Off

Disable antialiasing.