Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AnnealSteps

-

Set simulated annealing steps


CommandArgumentDatatypeDefault Min Max
Format: AnnealSteps Number = Number of simulation steps between cooling eventsINT---
Python:AnnealSteps(number)
Menu:Simulation > Temperature control > Parameters
Related:Temp , TempCtrl, MinStep
Required:


The AnnealSteps command influences the speed of cooling during a simulated annealing minimization activated with TempCtrl Anneal.

A simulated annealing minimization usually follows an initial short steepest descent minimization (to remove bumps), since it's much faster at finding the energy minimum.

During simulated annealing, the simulation cell is slowly cooled towards 0K by downscaling the atom velocities with 0.9. The AnnealSteps command specifies how many simulation steps lie between two scaling events. The higher the number, the slower the annealing.

Example:
AnnealSteps 10

Multiply atom velocities with 0.9 every 10 simulation steps.