Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AnimateWin

-

Animate Windows


CommandArgument DatatypeDefaultMinMax
Format:AnimateWin Type = Off | Blend | Rotate | Zoom | TiltSTRING ---
Python: AnimateWin(Type)
Menu:Window > Animation
Related: StyleWin , WinTexture, WinFont
Required:


The AnimateWin command animates the (dis)appearance of windows in various ways. 'Blending' is the default.

Example 1:
AnimateWin Off

Do not animate the windows.


Example 2:
AnimateWin Blend

Blend the windows.


Example 3:
AnimateWin Rotate

Rotate the windows.


Example 4:
AnimateWin Zoom

Zoom the windows.