Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AnimateImage

-

Animate appearance and disappearance of images


CommandArgument DatatypeDefaultMinMax
Format:AnimateImageImage selection, SELECTION---
  Enter = fromLeft | fromRight | fromTop | fromBottom | Circle | Jump | BlendLeft | BlendRight | BlendTop | BlendBottom | Pop, STRINGfromLeft - -
   Rest = Time to rest on screen in update cycles,INT200- -
   Leave = toLeft | toRight | toTop | toBottom | Circle | Drop | BlendLeft | BlendRight | BlendTop | BlendBottom | Pop, STRINGtoRight --
  Steps = Number of steps to complete enter/leave animations in update cycles INT100--
Python: AnimateImage(selection1,enter=None,rest=None,leave=None,steps=None)
Menu:Effects > Image > Animate
Related: LoadBMP , LoadPNG, ShowImage , AutoMoveImage, HideImage , DelImage, SwapImage , UnrestImage, MakeImageObj
Required:


Do not forget to show the image before animating it.

If you want the image to rest on screen until a mouse button is pressed, choose a very long rest time (e.g. 100000), then issue a Wait command and finally use UnrestImage to continue the animation.

Example 1:
AnimateImage 2,Enter=fromRight,Rest=200,Leave=toBottom,Steps=100

Let image 2 enter the screen from the right side with 100 steps, rest on screen for 200 cycles, and leave to the bottom with 100 steps.


Example 2:
AnimateImage 3,Enter=Circle,Rest=300,Leave=BlendTop,Steps=150

Let image 3 fly onto the screen in a circle with 150 steps, rest on screen for 300 cycles, and blend it away to the top.