Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Angle

-

Set/get angle between atoms


CommandArgument DatatypeDefaultMinMax
Format:AngleAtom selection 1,SELECTION - --
  Atom selection 2,SELECTION - --
  Atom selection 3,SELECTION - --
  bound = Yes | No,STRING No --
  set = new angle in degreesFLOAT - --
Python:Angle(selection1,selection2,selection3,bound,set)
resultlist = Angle(selection1,selection2,selection3,bound=None)
Menu: Edit > Geometry > Angle
Analyze > Geometry > Angle
Related: Distance , Dihedral, GroupAngle , GroupDistance, GroupDihedral
Required:


The Angle command measures the angles between all atom triplets in the three selections.

If the Bound flag is set, only angles formed by chemically bound atoms are considered.

If a new angle is specified with the Set parameter, the third selected atom (and all covalently connected ones) will be moved to arrive at the new angle. This requires that the angle to set is not part of a closed loop. Atoms that are not covalently bound (e.g. metals) will not be moved along, which can be fixed afterwards by additionally re-setting the distance between one coordinating atom and the metal ion.

Angles can be changed interactively from the atom context menu in two ways:
  • If three atoms are marked with white, green and red fireflies, click Geometry > Angle to adjust the angle formed by these three atoms.
  • If at least two atoms are marked with white and red fireflies, click Geometry > Bond angles to adjust up to four bond angles that link the two marked atoms. Note that this feature is only available in YASARA Model and above.

To measure angles between arbitrary points that do not coincide with atoms (like the center of a phenyl ring) build dummy atoms at these points first or use the GroupAngle command.

Example 1:
Angle 105,109,114

Calculate the angle formed by the three atoms 105, 109 and 114.


Example 2:
Angle 1,5,CA

Calculate the angles formed by atoms 1, 5 and all CA atoms.


Example 3:
Angle CA,CB,CG,bound=Yes

List all angles between bound CA-CB-CG atoms.


Example 4:
ang = Angle 200,300,400

Assign the angle between atoms 200, 300 and 400 to variable 'ang'.


Example 5:
Angle 105,109,114,set=120

Set the angle between atoms 105,109 and 114 to 120 degrees.