Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

A message about /dev/nvidiactl permission problems appears in the Linux terminal

If YASARA does not start, but a message like


Error: Could not open /dev/nvidiactl because the permissions
       are too restrictive.  Please see the FREQUENTLY ASKED QUESTIONS
       section of /usr/share/doc/NVIDIA_GLX-1.0/README for steps
       to correct.

appears, become root and run the following commands:

chmod 0666 /dev/nvidia*
chown root /dev/nvidia*

To prevent the problem from reappearing, it may help to reconfigure the security module of the PAM system. In most cases this security system works, but it can get confused. Different Linux distributions have different files to control this; please consult with your distributor for the correct method of disabling this security feature. As an example, if your system has the file /etc/security/console.perms then you should edit the file and remove the line that starts with 'dri' (we have also received reports that additional references to dri in console.perms must be removed). If instead your system has the file /etc/logindevperms then you should edit the file and remove the line that lists /dev/nvidiactl. The above steps will prevent the PAM security system from modifying the permissions on the NVIDIA device files.