Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AlignObj

-

Align objects


CommandArgument DatatypeDefaultMinMax
Format:AlignObj Source selection, SELECTION- - -
   Destination selection, SELECTION---
  method = Motif STRING---
Python:resultlist = AlignObj(selection1,selection2,method)
Menu:Analyze > Align
Related: Sup , RMSD
Required:


The Align command maps to WHAT IF's MOTIF option and structurally aligns the source objects with the destination object.

For the two selected objects, MOTIF will try to do a 3D superposition of every stretch of every length in the first range on every stretch of the same length in the other protein. Some nifty little tricks ensure that this command nevertheless executes in less than no time.

The command also prints an alignment of structurally equivalent residues. Especially for large proteins, this alignment may not be complete, but you can click the top right button in the sequence selector to let YASARA calculate and display a clickable structural alignment.

The alignment algorithm is described in:

Detection of common three-dimensional substructures in proteins

Vriend G, Sander C (1991) Proteins 11,52-58

The general recipe is as follows:
  • Use only Calphas. When residues are mentioned, we actually mean their alpha carbons.
  • Find the longest possible groups of minimally four consecutive residues in both chains that have each other as the nearest partner in the other chain. Use only inter-chain residue pairs that are closer to each other than 3 Angstrom.
  • Residues at the end of such groups are added, if their pairwise distance is less than 5 Angstrom, and if there are no "unassigned" residues nearer by.
  • If two groups are separated by just one residue (sequence wise) in both chains, this one residue pair is added, independent of the distance between those two residues.
  • This recipe above is iterated 10 times.
  • Determine the structure superposition using only the aligned residue pairs. This method is based on a method by Wolfgang Kabsch.
  • This fine-tuning recipe, in turn, is iterated 10 times, or until the overall RMS alpha carbon displacement between two consequetive steps is less than 0.001 Angstrom.

The Align command returns the Calpha RMSD of the aligned residues. If you need to know the actual transformation matrix, use WHAT IF's '%SHOMAT'.

Since an iterative procedure is used to determine the alignment, the result cannot be guaranteed to be symmetric, i.e. superposing object 1 on object 2 may give a slightly different result than superposing object 2 on object 1.

Example 1:
AlignObj 1,2

Take object 1 and put in on top of object 2 so that the (structural) alignment is optimal.


Example 2:
rmsd = AlignObj 1,2

As above, and assign the Calpha RMSD of the aligned regions to variable 'rmsd'.


Example 3:
rmsdmtx() = AlignObj all,all

Align all objects with all objects and assign the RMSD matrix to 'rmsdmtx'.