Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

A logical OR is assumed between items of the same selection type

If you specify more than one item of the same type, you must separate them with a space, and YASARA implicitly treats this space as a logical OR.

Examples:
ColorAtom 350 CA CB,Red
Color atoms with number 350 or name CA or name CB red
ColorRes Lys Arg His,Blue
Color residues named Lys or Arg or His blue
DelMol B E
Delete all molecules named 'B' or 'E'
RemoveObj 1 1crn
Remove objects with number 1 or name 1crn from the soup