Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

A logical AND is assumed if you switch the selection type

It is easily possible to switch the selection type in the middle of a selection by including one of the All, Obj, Mol, Res and Atom keywords. YASARA implicitly treats this change as a logical AND. Note that the implicit OR has a higher priority than the implicit AND.

Examples:
ColorAtom CA CB Res Lys Arg,Red
Color atoms with name CA or CB and belonging to Lys or Arg residues red
ColorRes Lys Mol A,Blue
Color residues named Lys and belonging to molecule A blue
DelMol B E Obj 5-6
Delete all molecules named 'B' or 'E' and belonging to objects 5 or 6
DelMol B E Obj 5 Obj 6
Same as above, since the second 'Obj' does not switch the selection type