Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AddSpring

-

Link atoms with a spring


CommandArgument DatatypeDefaultMinMax
Format:AddSpring Atom selection 1, SELECTION- - -
   Atom selection 2,SELECTION - --
  Len = Spring length in Å,FLOAT 2.5 --
  SFC = Spring stretching force constant in N/mFLOAT 100.0--
Python: AddSpring(selection1,selection2,len=None,sfc=None)
Menu:Simulation > Link atoms
Related: AddBond
Required:


The AddSpring command adds a distance constraint between the selected atoms to the current force field, which must have been initialized before. Changes to the soup clear the force field and therefore also all added springs. If you have many springs to add, it is best to create a macro so that you do not have to do it multiple times (springs are not saved).

All springs are displayed in the bottom right simulation HUD (together with bonds and angles). Use the keys <Home> and <End> to cycle through the springs and note that they will be listed only in one direction (at the atom with the higher number).

The easiest way to add springs manually is by marking two atoms like when measuring a distance, and then clicking 'Link atoms' in the atom context menu of the atom marked with white fireflies.

There is currently no command to delete springs. Just stop the simulation and reinitialize the force field to delete all springs.

When the force field is initialized , the AddSpring command is invoked automatically to add distance constraints to metal ions if pseudo bonds (headless arrows) are present .

If you need to create a very large number springs , all involving the same atom, make sure that this atom has a lower number than the linked atoms. Springs are stored at the atom with the higher number, and the number of springs per atom is limited.

A practical example showing how to create an alpha-helix with AddSpring can be found at the ShowSecStr command.

Example 1:
AddSpring H Res 34,O Res 38,Len=2,SFC=75

Link atom H in residue 34 with atom O in residue 38 with a 5 A long spring whose force constant is 75 N/m.


Example 2:
AddSpring 105,107-109,6,10

Link atom 105 with 107,108 and 109 using 6 A long springs with a 10 N/m force constant.