Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AddRes

-

Add terminal residue


CommandArgument DatatypeDefaultMinMax
Format 1:AddResName = Amino acid residue name, STRING- - -
   Object selection, SELECTION---
  Omega = Omega angle in degrees,FLOAT 180.0--
   Phi = Phi angle in degrees,FLOAT 180.0--
   Psi = Psi angle in degrees FLOAT180.0 --
Format 2:AddResName = Nucleotide residue name, STRING---
  Object selection, SELECTION---
  Epsilon = Epsilon angle to previous residue in degrees,FLOAT155.0 --
  Zeta = Zeta angle to previous residue in degrees ,FLOAT-95.18--
  Alpha = Alpha angle in degrees,FLOAT -46.85--
   Beta = Beta angle in degrees,FLOAT -146.06--
   Gamma = Gamma angle in degrees FLOAT36.41 --
Python:AddRes(name,selection1,omega=None,phi=None,psi=None)
AddRes2(name,selection1,epsilon=None,zeta=None,alpha=None,beta=None,gamma=None)
Menu:Edit > Add > to soup: Residue
Related:BuildRes, BuildMol
Required:


The AddRes command adds an amino acid to the C-terminal end, or a nucleotide to the 3' end of the selected object, using the specified dihedral angles.

Depending on the chosen residue name, the command expects a different selection of dihedral angles.

Building peptides:

The residue name can be any of the 20 amino acids in three letter code, as well as one of the special residue names listed here.

The Phi / Psi angles corresponding to the various secondary structure types can be found here.

Omega is the dihedral angle of the peptide bond, usually 180 degrees for trans- and 0 degrees or cis-peptide bonds.

After building the first residue with BuildRes , you can use AddRes to extend the peptide, forming any secondary structure you want:


# EXAMPLE: BUILD A HELIX WITH A GIVEN SEQUENCE
phi = -50
psi = -50
sequence = 'Ser','Ile','Val','Ala','Arg','Ser','Asn','Phe','Asn','Val','Cys'
# BUILD THE FIRST RESIDUE
peptide = BuildRes (sequence(1)),(psi)
# EXTEND THE PEPTIDE
for i=2 to count sequence
  AddRes (sequence(i)),(peptide),Phi=(phi),Psi=(psi)

Building nucleic acids:

The residue name can be any of the four RNA nucleotides A, U, G and C, or one of the four DNA deoxy-nucleotides DA, DT, DG and DC. The latter four residue names match the new PDB format version 3.0.

The dihedral angles Epsilon and Zeta define the conformation of the newly added residue with respect to the previous residue and are therefore specified first (in the figure below, they would be just above Alpha, not where they are indicated), while Alpha, Beta and Gamma are internal dihedral angles as shown in the figure below:

Figure: Backbone dihedral angles in nucleotides. Saenger W., Principles of Nucleic Acid Structure, Springer New York 1984

Different DNA/RNA conformations can be built using these sets of default dihedral angles (the Delta and Chi dihedrals are not modified by this command):

Structure type Alpha Beta Gamma Delta EpsilonZeta Chi
B-DNA (YASARA) -46.85 -146.0636.41156.38155 -95.18-97.8
RNA (YASARA) -66.8 153 68.1 82.4 -140 -75.4 -173
A-DNA (fibres) -50 172 41 79 -146 -78 -154
GGCCGGCC -75 185 56 91 -166 -75 -149
B-DNA (fibres) -41 136 38 139 -133 -157 -102
CGCGAATTCGCG -63 171 54 123 -169 -108 -117
Z-DNA (C residues)-137 -139 56 138 -95 80 -159
Z-DNA (G residues)47 179 -169 99 -104 -69 68
DNA-RNA decamer -69 175 55 82 -151 -75 -162
A-RNA -68 178 54 82 -153 -71 -158

(Blackburn and Gait, Nucleic acids in chemistry and biology, Oxford University Press New York 1996. Many thanks to IMB Jena for compiling this information. Note: except for the first two entries, the table above is reproduced without validation).

Example 1:
AddRes Lys,1crn,Phi=50,Psi=50

Add a lysine residue to the C-terminus of object 1crn, with angles Omega/Phi/Psi = 180/50/50.


Example 2:
AddRes DA,Strand1,Epsilon=155,Zeta=-95,Alpha=-47,Beta=-146,Gamma=36

Add a deoxy-adenosine residue to the 3' end of object strand1, using a classic B-DNA conformation.