Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AddPos<Atom|Res|Mol>

-

Sum atom positions to calculate average and standard deviation


CommandArgument DatatypeDefaultMinMax
Format:AddPos<Atom|Res|Mol> SelectionSELECTION - --
Python:AddPos<Atom|Res|Mol>(selection1)
Menu:This command is mainly useful for macros. There is no menu entry.
Related:AveragePos , RMSF, RMSD , Sup
Required:


The AddPos command adds the positions of the selected atoms to an internal table. Using this table, you can then calculate average atom positions and root mean square fluctiations. A detailed description of the procedure can be found at the AveragePos and RMSF commands.

Example 1:
AddPosAtom Obj 1

Add the positions of the atoms in object 1 to an internal per-atom table for average and RMSF calculation.


Example 2:
AddPosAtom CA Obj 1

As above, but consider only the Calpha atoms.


Example 3:
AddPosRes Obj 2

Add the positions of the geometric centers of the residues in object 2 to an internal per-atom table for average and RMSF calculation, duplicating the per-residue result for each atom.