Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Add<Obj|All>

-

Add objects to the soup


CommandArgument DatatypeDefaultMinMax
Format:Add<Obj|All> Object selectionSELECTION ---
Python: resultlist = Add<Obj|All>(selection1)
Menu:Edit > Add > to soup: Object
Related:RemoveObj, DelObj
Required:


The Add command adds objects that have been removed before (e.g. to exclude them from simulations) back to the soup.

For more details, look in the essentials section .

Example 1:
AddObj 5

Add object 5 to the soup.


Example 2:
first,last = AddObj 1crn

Add object 1crn to the soup and assign the numbers of the first and last atom to variables 'first' and 'last'.