Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AddHyd<Atom|Res|Mol|Obj|All>

-

Add missing hydrogens


CommandArgument DatatypeDefaultMinMax
Format:AddHyd<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   Number = 1 | 2 | 3 | 4 | All, STRINGAll - -
   update = Yes | NoSTRING Yes --
Python:AddHyd<Atom|Res|Mol|Obj|All>(selection1,number=None,update=None)
Menu:Edit > Add > hydrogens to
Related: DelHyd , OptHyd, Experiment , Clean, AddCap
Required:


The AddHyd command adds hydrogens to the selected atoms according to basic chemistry rules and the currently selected pH. Complicated cases like protonation of Asp, Glu and His residues in the context of the structural environment are handled via pKa prediction by 'Experiment Neutralize'. The initial hydrogen positions are not always in the energy minimum, a simulated annealing minimization is therefore required after AddHyd. Flipping of Asn, Gln and His side-chains to optimize the hydrogen bonding network can be done with the Twinset OptHyd command.

The second parameter defining the number of hydrogens is mainly useful in cases where you want to manually override the default, e.g. to protonate a Histidine residue.

If the update flag is set, the AddHyd command will update the bond orders within the selected residues, e.g. if you add one hydrogen atom to a deprotonated carboxyl group, the bond orders between the carbon and the oxygens will change from 1.5 (deprotonated) to 1 and 2 (neutral).

If AddHyd gives a surprising result, e.g. adds hydrogens where none are expected, this can have mainly two reasons:

  • You are working with a scene or YASARA object created with versions older than 5.8.21, before YASARA could type bonds automatically. Just click Edit > Type bonds, select all and try again.

  • The result is correct with respect to the currently selected pH, but is not the one you expected. In this case, click Options > Default pH to shift the pH. Details about pH dependent protonation patterns can be found in the GROUP_DATA section of the file yasara.def, present in YASARA Dynamics+.

More information about how YASARA analyzes structures to determine how many hydrogens need to be added as a function of the current pH can be found here .

Example 1:
AddHydObj 1crn

Add missing hydrogens to object 1crn.


Example 2:
AddHydRes Lys 50,Number=all

Add all missing hydrogens to residue Lys 50.


Example 3:
AddHydAtom NE2 Res His,Number=1,update=No

Add one hydrogen to all NE2 atoms in Histidines and do not update the bond orders.



Example macro:

# EXAMPLE AddHyd
Clear
LoadPDB 1c9b
# Splitting large objects before adding hydrogens speeds things up
SplitObj 1c9b
AddHydAll

Figure: Result of the example macro above.