Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AddEnv<Atom|Res|Mol|Obj|All>

-

Add to environment for surface calculations


CommandArgument DatatypeDefaultMinMax
Format:AddEnv<Atom|Res|Mol|Obj|All> Selection SELECTION- - -
Python: AddEnv<Atom|Res|Mol|Obj|All>(selection1)
Menu:Edit > Add > to surface environment
Related:RemoveEnv, ShowSurf , HideSurf, ColorSurf , Surf, SurfPar
Required:


All selected atoms are marked as belonging to the environment that is considered when showing surfaces or calculating surface areas.

The surface environment allows to show only parts of a surface. When creating a surface, YASARA first builds a complete surface containing all atoms that belong to the surface environment or are selected by the ShowSurf/Surf command. From this initial surface, only the portion belonging to the atoms selected by ShowSurf/Surf is kept.

Changes to the environment immediately influence dynamic surfaces but have no effect on static surface objects created previously.

The environment is saved with scenes and single objects.

Example 1:
AddEnvAll

Consider contributions from all atoms when showing surfaces and calculating surface areas.


Example 2:
AddEnvRes Protein

Add all protein residues to the environment considered when showing surfaces and calculating surface areas.


Example 3:
AddEnvAtom CA

Add all CA atoms to the surface environment.



Example macro:

# EXAMPLE AddEnv
# Requires YASARA Model
Clear
# Water probe radius 1.5 A, medium resolution, analytic molecular surfaces
SurfPar Probe=1.5,Resolution=3,Molecular=Analytic
# Opacity of surface outsides and insides
surfalphaout=100, 60,  0,   20
surfalphain =100, 100, 100, 50
# Surface types and colors 
surftype='VdW','Molecular','Accessible'
surfcol='ff0000','ff8000','ffff00'
# Show 4x3 surfaces
for y=1 to 3
  # Display surface type
  obj=MakeTextObj Name=SurfType,Width=40,Height=3
  Font Times,Height=3,Color=(surfcol(y)),Depth=4.0,DepthCol=303030
  PosText 50%,0%,Center
  Print (surftype(y))
  PosObj (obj),-40,(-(y-2)*20),75
  OriObj (obj),Gamma=90
  for x=1 to 4
    obj=LoadPDB peptide8
    PosObj (obj),(20*(x-2)-5),(-(y-2)*18),75
    # Consider the entire object when showing surfaces
    # (also residue 2 excluded below)
    AddEnvObj (obj)
    # Show and color surface (exclude residue 2 to get a hole)
    ShowSurfRes not 2 and Obj (obj),(surftype(y)),Update=Static,OutCol=AtomCol,
                OutAlpha=(surfalphaout(x)),InCol=Green,InAlpha=(surfalphain(x))
Style BallStick,Stick
AutoRotateObj !SurfType,Y=0.2
HUD Off

Figure: Result of the example macro above.