Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AddBond

-

Add covalent bonds


CommandArgument DatatypeDefaultMinMax
Format:AddBondAtom selection 1,SELECTION - --
  Atom selection 2,SELECTION - --
  Order = Bond order, FLOAT1.01.03.0
  update = Yes | NoSTRINGYes--
Python:AddBond(selection1,selection2,order=None,update=None)
Menu:Edit > Add > to soup: Bond
Related: DelBond , SwapBond, TypeBond , pH, AddSpring
Required:


The AddBond command adds a covalent bond of the specified order between the selected atoms. If two atoms are already bound, the old bond is deleted and replaced with the new one (the same action is performed by the SwapBond command).

The easiest way to add a bond manually is by marking two atoms like when measuring a distance, and then clicking 'Add > to soup: Bond' in the atom context menu of the atom marked with white fireflies.

In addition to the usual single, double, triple and quadruple bonds, five intermediate bonds with resonance effects (bond orders 1.25, 1.33, 1.5, 1.66 and 1.75) are also supported.

The bond orders can be visualized in two ways:

  • Click one of the two atoms forming the bond, then look at the bottom part of the 'Atom properties' HUD. Special characters are used to indicate the bond order, as explained in the table below.

The following bond orders are supported by YASARA:

Name OrderSym Color Example
Single bond 1 - gray CH4
Resonance bond 1.25 _ blue Phosphate PO4---
Resonance bond 1.33 ^ magenta Carbonate CO3--
Resonance bond 1.5 ~ red Carboxyl group XCO2-, Sulfate SO4--, Benzene
Resonance bond 1.66 + orange Sulfite HSO3-
Resonance bond 1.75 " br.orange4 outer edge bonds in Anthracene
Double bond 2 = yellow Carbonyl group C=O, CO2
Triple bond 3 # green N#CX
Quadruple bond 4 $ cyan -

By using fractional bond orders, YASARA can preserve the true symmetry of molecules with resonance effects , leading to more efficient and accurate assignments of pH dependent protonation patterns and force field parameters. More details about this concept can be found here.

If the selected object contains hydrogen atoms, the AddBond command will automatically update all hydrogens to match the new bond order, unless the update flag is set to 'no'. E.g. if you have an ethane molecule and add a double bond between the two carbons, the six sp3 hydrogens will be replaced by four sp2 hydrogens, resulting in ethene.

Each atom in the soup can form at most four covalent bonds, adding additional bonds is not possible, but also not needed: When working with metal ions that tend to form more than four 'bonds', use the ShowArrow command to visualize them (YASARA automatically replaces bonds to metals with arrow cylinders when loading a PDB file). Due to the ionic nature of these 'bonds', also molecular dynamics force fields usually cannot cope with them and instead rely on purely electrostatic interactions. Since this approach does not always prove successful, YASARA additionally adds a distance contraint when initializing the force field for each pseudo-bond to a metal ion.

Example 1:
AddBond 105,109,1.5

Link atoms 105 and 109 with a resonance bond of order 1.5.


Example 2:
AddBond 105,109,2

Link atoms 105 and 109 with a double bond.


Example 3:
AddBond 105,109-111,update=No

Link atom 105 with atoms 109,110 and 111 using single bonds, but do not update surrounding hydrogens to match the new bonds.